Review



multiple tissue cdna panel 1  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa multiple tissue cdna panel 1
    Multiple Tissue Cdna Panel 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 605 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pmc11133409-369-8-13
    Average 95 stars, based on 605 article reviews
    multiple tissue cdna panel 1 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Isolation:

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis
    Article Snippet: The pMSCV-IRES-DsRed-Monomer was made by replacing EGFP with DsRed-Monomer amplified from pDsRed-Monomer-C1 (Clontech Laboratories, Moutain View, CA, USA) using TACCGGTCGCCA CCATGG AC and ATTTATA GCGGCCGC TTTACTGGGAGCCGGAGTGGC. .. MYC was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA Panel 1 (Clontech Laboratories) using the primers; ACGT GAATTC CACCATGCCCCTCAACGTTAGCTTC and TACGT CTCGAG CTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and XhoI sites of pMSCV-IRES-EYFP to obtain the pMSCV-MYC-IRES-EYFP expression vector. pMSCV-BCLXL-IRES-DsRed-Monomer was obtained by subcloning of an EcoRI fragment containing human BCLXL from the pLXIN-BCLXL expression vector [ ]. ..

    Polymerase Chain Reaction:

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis
    Article Snippet: The pMSCV-IRES-DsRed-Monomer was made by replacing EGFP with DsRed-Monomer amplified from pDsRed-Monomer-C1 (Clontech Laboratories, Moutain View, CA, USA) using TACCGGTCGCCA CCATGG AC and ATTTATA GCGGCCGC TTTACTGGGAGCCGGAGTGGC. .. MYC was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA Panel 1 (Clontech Laboratories) using the primers; ACGT GAATTC CACCATGCCCCTCAACGTTAGCTTC and TACGT CTCGAG CTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and XhoI sites of pMSCV-IRES-EYFP to obtain the pMSCV-MYC-IRES-EYFP expression vector. pMSCV-BCLXL-IRES-DsRed-Monomer was obtained by subcloning of an EcoRI fragment containing human BCLXL from the pLXIN-BCLXL expression vector [ ]. ..

    Ligation:

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis
    Article Snippet: The pMSCV-IRES-DsRed-Monomer was made by replacing EGFP with DsRed-Monomer amplified from pDsRed-Monomer-C1 (Clontech Laboratories, Moutain View, CA, USA) using TACCGGTCGCCA CCATGG AC and ATTTATA GCGGCCGC TTTACTGGGAGCCGGAGTGGC. .. MYC was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA Panel 1 (Clontech Laboratories) using the primers; ACGT GAATTC CACCATGCCCCTCAACGTTAGCTTC and TACGT CTCGAG CTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and XhoI sites of pMSCV-IRES-EYFP to obtain the pMSCV-MYC-IRES-EYFP expression vector. pMSCV-BCLXL-IRES-DsRed-Monomer was obtained by subcloning of an EcoRI fragment containing human BCLXL from the pLXIN-BCLXL expression vector [ ]. ..

    Expressing:

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis
    Article Snippet: The pMSCV-IRES-DsRed-Monomer was made by replacing EGFP with DsRed-Monomer amplified from pDsRed-Monomer-C1 (Clontech Laboratories, Moutain View, CA, USA) using TACCGGTCGCCA CCATGG AC and ATTTATA GCGGCCGC TTTACTGGGAGCCGGAGTGGC. .. MYC was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA Panel 1 (Clontech Laboratories) using the primers; ACGT GAATTC CACCATGCCCCTCAACGTTAGCTTC and TACGT CTCGAG CTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and XhoI sites of pMSCV-IRES-EYFP to obtain the pMSCV-MYC-IRES-EYFP expression vector. pMSCV-BCLXL-IRES-DsRed-Monomer was obtained by subcloning of an EcoRI fragment containing human BCLXL from the pLXIN-BCLXL expression vector [ ]. ..

    Article Title: Loss of the smallest subunit of cytochrome c oxidase, COX8A, causes Leigh-like syndrome and epilepsy.
    Article Snippet: Total fibroblast RNA was obtained by disrupting cells in TRIzol Reagent (Life Technologies) followed by isolation of the RNA with the RNeasy MiniKit (Qiagen). .. Tissue-specific expression of COX8A and COX8C was investigated using the Human Multiple Tissue cDNA Panel 1 from Clontech Laboratories, Inc., and FirstChoice Human Brain Total RNA from testis (Ambion). .. Complementary DNA was produced from RNA templates with the iScript TM Select cDNA synthesis kit (Bio-Rad) using random primers for reverse transcription.

    Subcloning:

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis
    Article Snippet: The pMSCV-IRES-DsRed-Monomer was made by replacing EGFP with DsRed-Monomer amplified from pDsRed-Monomer-C1 (Clontech Laboratories, Moutain View, CA, USA) using TACCGGTCGCCA CCATGG AC and ATTTATA GCGGCCGC TTTACTGGGAGCCGGAGTGGC. .. MYC was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA Panel 1 (Clontech Laboratories) using the primers; ACGT GAATTC CACCATGCCCCTCAACGTTAGCTTC and TACGT CTCGAG CTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and XhoI sites of pMSCV-IRES-EYFP to obtain the pMSCV-MYC-IRES-EYFP expression vector. pMSCV-BCLXL-IRES-DsRed-Monomer was obtained by subcloning of an EcoRI fragment containing human BCLXL from the pLXIN-BCLXL expression vector [ ]. ..



    Similar Products

    95
    TaKaRa multiple tissue cdna panel 1
    Multiple Tissue Cdna Panel 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pmc11133409-369-8-13
    Average 95 stars, based on 1 article reviews
    multiple tissue cdna panel 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Becton Dickinson human multiple tissue cdna panel-1
    Human Multiple Tissue Cdna Panel 1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/human+multiple+tissues+cdna+panel+1/pmc03991570-133-21-26
    Average 90 stars, based on 1 article reviews
    human multiple tissue cdna panel-1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    95
    TaKaRa human multiple tissue cdna mtc panel 1
    Human Multiple Tissue Cdna Mtc Panel 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pmc03290626-63-12-19
    Average 95 stars, based on 1 article reviews
    human multiple tissue cdna mtc panel 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa human multiple tissue cdna panel 1
    Human Multiple Tissue Cdna Panel 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pm31155743-80-9-20
    Average 95 stars, based on 1 article reviews
    human multiple tissue cdna panel 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa mtc multiple tissue cdna panels human 1
    Mtc Multiple Tissue Cdna Panels Human 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pm20882035-56-0-16
    Average 95 stars, based on 1 article reviews
    mtc multiple tissue cdna panels human 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa multiple tissue cdna panels 1
    Multiple Tissue Cdna Panels 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+multiple+tissue+cdna+panel+1/Human+MTC+Panel+I/pm20833645-128-83-92
    Average 95 stars, based on 1 article reviews
    multiple tissue cdna panels 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results